View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16531_high_5 (Length: 223)
Name: NF16531_high_5
Description: NF16531
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16531_high_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 159; Significance: 8e-85; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 19 - 207
Target Start/End: Complemental strand, 42099326 - 42099134
Alignment:
| Q |
19 |
cagcattccccacaaaatatcagagcttccaagtcgattgatctctttatattgctacctagctatctcatatg--atctgattctgaatatcttatgaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
42099326 |
cagcattccccacaaaatatcagagcttccaagacgattgatctctttatattgctacctagctatctcatatataatctgattctgaatatcttatgaa |
42099227 |
T |
 |
| Q |
117 |
tactct--aggtttcattttgcggtatattataaggaaatagtgcaatgatgaagataatcattaatttggttttaatagaaaagtaaaagta |
207 |
Q |
| |
|
|||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42099226 |
tactctctaggtttcgttttgcggtatattataaggaaatagtgcaatgatgaagataatcattaatttggttttaatagaaaagtaaaagta |
42099134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University