View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16533_high_109 (Length: 237)
Name: NF16533_high_109
Description: NF16533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16533_high_109 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 11 - 221
Target Start/End: Complemental strand, 20065565 - 20065356
Alignment:
| Q |
11 |
caaaggtttatgatcactgtttgtctttctttttgtttcagcacaaataattcatcaaaaataattattatcaaagtttcgaaaaccccaaaagcaacat |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||| |||||||||||||||| ||| |
|
|
| T |
20065565 |
caaaggtttatgatcactgtttgtctttctttttgtttcagcacaaataattca-caaaaataactattatcaaagttttgaaaaccccaaaagcagcat |
20065467 |
T |
 |
| Q |
111 |
tgtttattataggtatcttttttgttacataaactggcacattttaataattttttaaaaaagacttgtgagtcgtggcagtttaataaaggccacacta |
210 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20065466 |
tgtttattataggtatttttgttgttacataaactggcccattttaataattttttaaaaaagacttgtgagtcgtggcagtttaataaaggccacacta |
20065367 |
T |
 |
| Q |
211 |
aactattttaa |
221 |
Q |
| |
|
||||||||||| |
|
|
| T |
20065366 |
aactattttaa |
20065356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University