View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF16533_high_112 (Length: 232)

Name: NF16533_high_112
Description: NF16533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF16533_high_112
NF16533_high_112
[»] chr6 (2 HSPs)
chr6 (143-215)||(31648954-31649026)
chr6 (18-77)||(31648829-31648888)


Alignment Details
Target: chr6 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 143 - 215
Target Start/End: Original strand, 31648954 - 31649026
Alignment:
143 ggcatgaattgtgtcatttgtattcttttcttcaactttagtcttctcaacctgcattgagccattttgcttc 215  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||    
31648954 ggcatgaattgtgtcatttgtattcttttcttcaactttagtgttctcaacctgcattgagccattttgcttc 31649026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 18 - 77
Target Start/End: Original strand, 31648829 - 31648888
Alignment:
18 ttaaccaatctaataacttctttatcaagttccttcttttccgtatttttatcttcaacc 77  Q
    |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
31648829 ttaatcaatctaataacttctttatcaagttccttcttttccgtatttttatcttcaacc 31648888  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University