View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16533_high_117 (Length: 225)
Name: NF16533_high_117
Description: NF16533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16533_high_117 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 8e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 8e-82
Query Start/End: Original strand, 16 - 209
Target Start/End: Complemental strand, 13629405 - 13629221
Alignment:
| Q |
16 |
aaggtataggcttctgctatatagttcagtatgagaaagcatacatcttgaatggaatgaataatagacgcaactatttattgtgttaaggggaatataa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
13629405 |
aaggtataggcttctgctatatagttcagtatgagaaagcatacatcttgaat---------aatagacgcaactatttattgtgttgaggggaatataa |
13629315 |
T |
|
| Q |
116 |
ttttgactcagatgttctggctttatgtattagtctttaggcagccttgtcactgaccttaagttgtacattaatgttgttttgcagtgatatt |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13629314 |
ttttgactcagatgttctggctttatgtattagtctttaggcaaccttgtcactgaccttaagttgtacattaatgttgttttgcagtgatatt |
13629221 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University