View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16533_high_62 (Length: 332)
Name: NF16533_high_62
Description: NF16533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16533_high_62 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 285; Significance: 1e-160; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 285; E-Value: 1e-160
Query Start/End: Original strand, 18 - 322
Target Start/End: Complemental strand, 55940716 - 55940412
Alignment:
| Q |
18 |
aagcccctggggataaatattgtggaccaatgcaactcatcatcctcactaagatgaatatatacaaattagcaagcataatctcaataaaataaagaaa |
117 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
55940716 |
aagcccccggggataaatattgtggaccaatgcaactcatcatcctcactaagatgaatatatacaaattggcaagcataatctcaataaaataaagaaa |
55940617 |
T |
 |
| Q |
118 |
ggactactctataggttattaagcaaatgtaaaatggttaaggttgatttgactttgtgagttcatttcatacataaactgacatacagaaaaagacaat |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
55940616 |
ggactactctataggttattaagcaaatgtgaaatggttaaggttgattagactttgtgagttcatttcatacacaaactgacatacagaaaaagacaat |
55940517 |
T |
 |
| Q |
218 |
ttggattcactgagccttgtagtcatctactcatttttagttgctcaatttctaggatgtgggagcgtcatcacatgtagtctacggtggaccgatattt |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55940516 |
ttggattcactgagccttgtagtcatctactcatttttagttgctcaatttctaggatgtgggagcgtcatcacatgtagtctacggtggaccgatattt |
55940417 |
T |
 |
| Q |
318 |
gaaat |
322 |
Q |
| |
|
||||| |
|
|
| T |
55940416 |
gaaat |
55940412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University