View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16533_high_70 (Length: 313)
Name: NF16533_high_70
Description: NF16533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16533_high_70 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 19 - 295
Target Start/End: Complemental strand, 5543242 - 5542966
Alignment:
| Q |
19 |
atattcaccacgacccagcatgtccacggtacaattggaccttctgggtcgggtgtatcaatatcctccacaacaagtgcaagagattttgtcccctcag |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
5543242 |
atattcaccacgacccagcatgtccacggtacaattggaccttctggatcgggtgtatcaatatcctccacaacaagtgcaagagattttgtcccctctg |
5543143 |
T |
|
| Q |
119 |
gtatgttgtaccattccaatggtggtgatatgtttttctttgctccttgtccttcatcagtgaattgtcttggtagttttccttcgtttgctattgctgg |
218 |
Q |
| |
|
||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5543142 |
gtaggttgtaccattctaatggtggtgatatgtttttctttgctccttgtccttcatcagtgaattgtcttggtagttttccttcgtttgctattgctgg |
5543043 |
T |
|
| Q |
219 |
tgacaccaacttgaacacttcacttccatcactagccatattgttgtttttctttagggtgttttttctttgcttct |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5543042 |
tgacaccaacttgaacacttcacttccatcactagccatattgttgtttttctttagggtgttttttctttgcttct |
5542966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University