View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16533_high_73 (Length: 306)
Name: NF16533_high_73
Description: NF16533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16533_high_73 |
 |  |
|
| [»] scaffold0008 (3 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0008 (Bit Score: 108; Significance: 3e-54; HSPs: 3)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 13 - 132
Target Start/End: Complemental strand, 49923 - 49804
Alignment:
| Q |
13 |
atgccttgggaaatattttggtgttgttcatccttggaggtatttttgcaggtgtaacagctgattggttatggttaattggtaaaggatggtgagagat |
112 |
Q |
| |
|
|||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49923 |
atgcattgggaaatatcttggtgttgttcatccttggaggtatttttgcaggtgtaacagctgattggttatggttaattggtaaaggatggtgagagat |
49824 |
T |
 |
| Q |
113 |
ctcagccatgctaaattaga |
132 |
Q |
| |
|
|||| ||||||||||||||| |
|
|
| T |
49823 |
ctcaaccatgctaaattaga |
49804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008; HSP #2
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 13 - 109
Target Start/End: Complemental strand, 62093 - 61997
Alignment:
| Q |
13 |
atgccttgggaaatattttggtgttgttcatccttggaggtatttttgcaggtgtaacagctgattggttatggttaattggtaaaggatggtgaga |
109 |
Q |
| |
|
|||| ||||||||||| ||||||||||| | || ||||||||||||||||| |||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
62093 |
atgcgttgggaaatatcttggtgttgtttcttctaggaggtatttttgcaggggtaacacttgattggttatggttaataggtaaaggatggtgaga |
61997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 227 - 282
Target Start/End: Complemental strand, 49769 - 49714
Alignment:
| Q |
227 |
tgaatatgtttagtgtttgcattttgtacaaagctaaatccaatttcggttaattt |
282 |
Q |
| |
|
||||||||||| |||||| |||| |||||||||||||||||||||| ||||||||| |
|
|
| T |
49769 |
tgaatatgtttggtgttttcattatgtacaaagctaaatccaattttggttaattt |
49714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 45 - 107
Target Start/End: Original strand, 21091607 - 21091669
Alignment:
| Q |
45 |
cttggaggtatttttgcaggtgtaacagctgattggttatggttaattggtaaaggatggtga |
107 |
Q |
| |
|
||||||||| |||||| ||| |||||| ||| ||| |||||||||| ||||||||||||||| |
|
|
| T |
21091607 |
cttggaggtctttttgtaggggtaacacttgactggctatggttaataggtaaaggatggtga |
21091669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University