View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16533_high_75 (Length: 304)
Name: NF16533_high_75
Description: NF16533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16533_high_75 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 180; Significance: 3e-97; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 101 - 288
Target Start/End: Complemental strand, 4051740 - 4051553
Alignment:
| Q |
101 |
aaaatcagaagcttctattaacaacttgtgtttccttattacatacctaagaattgtgcttcttgtacatatttccttaaacacaaatgttttgatttac |
200 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4051740 |
aaaatcaggagcttctattaacaacttgtgtttccttattacatacttaagaattgtgcttcttgtacatatttccttaaacacaaatgttttgatttac |
4051641 |
T |
|
| Q |
201 |
taggcaacaccagcttagaggatgctatatcttggatggttgatcatgagaatgacacagatattgatgagattccattggtactttc |
288 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4051640 |
taggcaacaccagcttagaggatgctatatcttggatggttgatcatgagaatgacacagatattgatgagattccattggtactttc |
4051553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University