View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16533_high_83 (Length: 294)
Name: NF16533_high_83
Description: NF16533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16533_high_83 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 1 - 284
Target Start/End: Original strand, 26277565 - 26277849
Alignment:
| Q |
1 |
gctgtgcaccgctatgtttgcaattgagaaagctgtggagctgaattggtcggacatatggattgaaacggactcacttatggtggtgaaagctttctct |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26277565 |
gctgtgcaccgctatgtttgcaattgagaaagctgtggagctgaattggtcggacatatggattgaaacggactcacttatggtggtgaaagctttctct |
26277664 |
T |
|
| Q |
101 |
caacacattgcagttccttggactttgagagttagatggcgcaattgtatag-cttaccgagactttttcttgtcgtttcacacacatccatagggagtg |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
26277665 |
caacacattgcagttccttggactttgagagttagatggcgcaattgtatagccttaccgagactttttcttgtcgttccacacacatccatagggagtg |
26277764 |
T |
|
| Q |
200 |
taactctggccaatgagtaagttaagcatggtcatagtttacactcacaatggtggacggatcccccacatttattttgcctttg |
284 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26277765 |
taactctggccaatgagtaagttaagcatggtcatagtttacactcacaatggtggacggatcccccacatttattttgcctttg |
26277849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University