View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16533_high_86 (Length: 279)
Name: NF16533_high_86
Description: NF16533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16533_high_86 |
 | |
|
| [»] scaffold0007 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 11 - 260
Target Start/End: Original strand, 46222808 - 46223057
Alignment:
| Q |
11 |
cagagagtgttaatactaactttgaggaatatgagagggagatggttggtgttggattgaagaagagtggaagtgtgaaggattatgtgatggattggat |
110 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46222808 |
cagagagtgttaatactagctttgaggaatatgagagggagatggttggtggtggattgaagaagagtggaagtgtgaaggattatgtgatggattggat |
46222907 |
T |
|
| Q |
111 |
tggaaaagaggtgaaggaagaaagaacaaagaatgatgatttggtgggtggaagtggaaagggagagaaaagtaagatgaagaagaaattggagtggtgg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46222908 |
tggaaaagaggtgaaggaagaaagaacaaagaatgatgatttggtgggtggaagtggaaagggagagaaaagtaagatgaagaagaaattggagtggtgg |
46223007 |
T |
|
| Q |
211 |
gaatcaatggatgaaggaaagagaaagggtgatttgaaaaaagagaagag |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46223008 |
gaatcaatggatgaaggaaagagaaagggtgatttgaaaaaagagaagag |
46223057 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 85 - 115
Target Start/End: Complemental strand, 227119 - 227089
Alignment:
| Q |
85 |
gtgaaggattatgtgatggattggattggaa |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
227119 |
gtgaaggattatgtgatggattggattggaa |
227089 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University