View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16533_high_96 (Length: 254)
Name: NF16533_high_96
Description: NF16533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16533_high_96 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 24 - 239
Target Start/End: Original strand, 8935524 - 8935739
Alignment:
| Q |
24 |
ccttggaattaatcttaacaggcagctctggaagcagcaagggttctgaatctcacgagcaataaatatttctcaggaccatacggtatggactatagtc |
123 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8935524 |
ccttggaattaatcttaacaggcagctctggaagcagcaagggttctgaatctcacgagcaataaatatttctcaggaccatacggtatggactatagtc |
8935623 |
T |
 |
| Q |
124 |
ataaatgatattcttgaaaacaactagctgaagatcatttaagcacgatgttttgattttcgttatgcaggcgaagatgtcattttcatcgctaatgatt |
223 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8935624 |
ataaatgatattcttgaaaacaactagctgaagatcatataagcacgatgttttgattttcgttatgcaggcgaagatgtcattttcatcgctaatgatt |
8935723 |
T |
 |
| Q |
224 |
ggcacacggcccttat |
239 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
8935724 |
ggcacacggcccttat |
8935739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University