View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16533_high_97 (Length: 254)
Name: NF16533_high_97
Description: NF16533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16533_high_97 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 13 - 254
Target Start/End: Original strand, 30360797 - 30361038
Alignment:
| Q |
13 |
gaacctgtgtaaggggtttacggaccttctctggaactgggattgggtccctgcaaggtacattcagatgaaaagaaatttaggctcactacttgtatca |
112 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30360797 |
gaacctgtgtaaggggtttgcggaccttctctggaactgggattgggtccctgcaaggtacattcagatgaaaagaaatttaggctcactacttgtatca |
30360896 |
T |
 |
| Q |
113 |
tcattgaaaatatgcatgcttcgaaaagnnnnnnnngtcctggttgttaaaatttctttggaagaaaatacgcatgcttnnnnnnngtcttgattgctca |
212 |
Q |
| |
|
|||||||||||||||||||||||||| | |||||||||||| |||||||||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
30360897 |
tcattgaaaatatgcatgcttcgaaatgaaaaaaaagtcctggttgtttaaatttcttttgaagaaaatacgcatgcttaaaaaaagtcttgattgctca |
30360996 |
T |
 |
| Q |
213 |
ctcttttaatactggttgcgccttaaattttctcatctgtgc |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30360997 |
ctcttttaatactggttgcgccttaaattttctcatctgtgc |
30361038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 113; Significance: 3e-57; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 113; E-Value: 3e-57
Query Start/End: Original strand, 18 - 138
Target Start/End: Original strand, 19916201 - 19916321
Alignment:
| Q |
18 |
tgtgtaaggggtttacggaccttctctggaactgggattgggtccctgcaaggtacattcagatgaaaagaaatttaggctcactacttgtatcatcatt |
117 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19916201 |
tgtgtaaggggtttgcggaccttctctggaactgggattgggtccctgcaaggtacattcatatgaaaagaaatttaggctcactacttgtatcatcatt |
19916300 |
T |
 |
| Q |
118 |
gaaaatatgcatgcttcgaaa |
138 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
19916301 |
gaaaatatgcatgcttcgaaa |
19916321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University