View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16533_low_101 (Length: 277)
Name: NF16533_low_101
Description: NF16533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16533_low_101 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 3 - 263
Target Start/End: Original strand, 38602801 - 38603061
Alignment:
| Q |
3 |
aggagaagcaaaggaaaaaaccaaaacaaacctgcaaaacgacgttgaggaaacaattgttgccgaggtttcgcaagccgggaacaaaaatgggtttatc |
102 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38602801 |
aggagaaacaaaggaaaaaaccaaaacaaacctgcaaaacgacgttgaggaaacaattgttgccgaggtttcgcaagccgggaacaaaaatgggtttatc |
38602900 |
T |
 |
| Q |
103 |
ggagtggttatcttgattataatctggtaataaagaagctaaagaaaaacgggacctaattggtttagaaaatttggcatcttttagagctaatacggaa |
202 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38602901 |
ggagtggttatcttgattataatctggtaataaagaagctaaagaaaaacgggacctaattggtttagaagatttggcatcttttagagctaatacggaa |
38603000 |
T |
 |
| Q |
203 |
gcagcaatggccgcaatggcagtaactgctgctacgcgaatcgtggtagaagaagatagtg |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
38603001 |
gcagcaatggccgcaatggcagtaactgctgctacgcgaatcctggtagaagaagatagtg |
38603061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University