View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16533_low_102 (Length: 276)
Name: NF16533_low_102
Description: NF16533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16533_low_102 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 240; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 240; E-Value: 1e-133
Query Start/End: Original strand, 18 - 276
Target Start/End: Complemental strand, 5755331 - 5755072
Alignment:
| Q |
18 |
atgcaagtagtatatgatatgctgagcaagaaggttagaaatagaaaaacaggacaaaaagagtgacgttgggtttatggaagcgggattaacgttttaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5755331 |
atgcaagtagtatatgatatgctgagcaagaaggttagaaatagaaaaacaggacaaaaagagtgacgttgggtttatggaagcgggattaacgttttaa |
5755232 |
T |
 |
| Q |
118 |
attggtattctctctctctaccactttcttaaaccttcttaaatcctgtcttgccacaaagtaaaactagaattagagtagtaacataagtactgttgtg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
5755231 |
attggtattctctctctctaccactttcttaaaccttcttaaatcctgtcttgccacaaagtaaaactagaattagagtagtaacataagtagtgttgtg |
5755132 |
T |
 |
| Q |
218 |
acatgctttaaaatctcacattgaaagcgcatatatgaag-catgcgctttcgtcatggc |
276 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| || ||||||||||||||||||| |
|
|
| T |
5755131 |
acatgctttaaaatctcacattgaaagcgcatgtatggagccatgcgctttcgtcatggc |
5755072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University