View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16533_low_103 (Length: 266)
Name: NF16533_low_103
Description: NF16533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16533_low_103 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 1 - 255
Target Start/End: Complemental strand, 10599815 - 10599561
Alignment:
| Q |
1 |
ctcaatatggttataatgatgatgcgattgatttgtttttggagatgttggtgagtagtgggtatgttccggataggtttacgttaactgggttgatatc |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||| |||||||| |||||||| |||||||||||||| |
|
|
| T |
10599815 |
ctcaatatggttataatgatgaagcgattgatttgtttttggaaatgttggtgagtagtgggtatgtgccggatagatttacgttgactgggttgatatc |
10599716 |
T |
|
| Q |
101 |
tgtgtgtgctgagattcagtttttgtcgcttgggaaggagttgcattcgtgggttattaggtcgggtttggttttggatttgtgtgttaggtgtagtttg |
200 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
10599715 |
ggtttgtgctgagattcagtttttgtcgcttgggaaggagttgcattcgtgggttattaggtcgggtttggttttggatttgtgtgttgggtgtagtttg |
10599616 |
T |
|
| Q |
201 |
gttgatatgtatgcgaaatgtggattggtgcgagaggctaggaaagtgtttgatg |
255 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10599615 |
gttgatatgtatgcgaaatgtggattggtgcaagaggctaggaaagtgtttgatg |
10599561 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University