View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16533_low_125 (Length: 238)
Name: NF16533_low_125
Description: NF16533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16533_low_125 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 25 - 223
Target Start/End: Original strand, 46808080 - 46808278
Alignment:
| Q |
25 |
tcacttataacatgcaacgttaagttttataaaaaatgcaaggactaaaatccgtaacaaaaagtttagagggacaaagttcaaaagaaatttatggctt |
124 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46808080 |
tcacttataacatgcaacattaagttttgtaaaaaatgcaaggactaaaatccataacaaaaagtttagagggacaaagttcaaaagaaatttatggctt |
46808179 |
T |
|
| Q |
125 |
ttttgtgtcatacatcaaaaaattcaacttattaaatgtattaaatgtgtcatacatagtaagataaaatgtcttttttggatttcctaacaagtgttc |
223 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46808180 |
ttttgtgtcatacatcaaaaaattcaacttattaaatgtattaaatgtgtcatacatagtaagataaaatgtcttttttggatttcctaacaagtgttc |
46808278 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University