View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16533_low_127 (Length: 238)
Name: NF16533_low_127
Description: NF16533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16533_low_127 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 13 - 220
Target Start/End: Complemental strand, 15155583 - 15155376
Alignment:
| Q |
13 |
tgaacgttgcagtttctttgaagatacatcatcacgctcttgtgaagaataatcacattccaccgtgttgtacctactcaaattgtagtaaaattagttg |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
15155583 |
tgaacgttgcagtttctttgaagatacatcatcccgctcttgtgaagaataatcacattccaccgtgttgtacctactcaaattgtagtaaaattggttg |
15155484 |
T |
|
| Q |
113 |
tttcttttatgggattacatctttcgaattttcctcgttcttttaaccaaacaatattgtataaaaaagtgtggaaaccatcgcaataacctagtcccaa |
212 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| |||| || |||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |
|
|
| T |
15155483 |
tttcttctatgggattacatctttcgaattttcctcattctattcaccaaacaatattgtataaaaaagtgtgaaaaccatcacaataacctagtcccaa |
15155384 |
T |
|
| Q |
213 |
acactcgc |
220 |
Q |
| |
|
|||||||| |
|
|
| T |
15155383 |
acactcgc |
15155376 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University