View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16533_low_131 (Length: 234)
Name: NF16533_low_131
Description: NF16533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16533_low_131 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 19 - 216
Target Start/End: Complemental strand, 28193243 - 28193046
Alignment:
| Q |
19 |
ctattttcttgacatcttcttgaatttgatgtcgatattctccaaaggtgaaattcttatacgtagaaggttctttgcagccacttatcgtagtagtgta |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
28193243 |
ctattttcttgacatcttcttgaatttgatgtcgatattctccaaaggtgaaattcttatacgtagaaggttctttgcagccacttatcatagtagtgta |
28193144 |
T |
 |
| Q |
119 |
agaaggacataggaagtatgcaatggagtatctttccactttgtcatttgccacgaccttgtgctctacgcttttgtactcatcattactccaggcct |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28193143 |
agaaggacataggaagtatgcaatggagtatctttccactttgtcatttgccacgaccttgtgctctacgcttttgtactcatcattactccaggcct |
28193046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University