View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16533_low_133 (Length: 232)
Name: NF16533_low_133
Description: NF16533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16533_low_133 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 69; Significance: 4e-31; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 143 - 215
Target Start/End: Original strand, 31648954 - 31649026
Alignment:
| Q |
143 |
ggcatgaattgtgtcatttgtattcttttcttcaactttagtcttctcaacctgcattgagccattttgcttc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
31648954 |
ggcatgaattgtgtcatttgtattcttttcttcaactttagtgttctcaacctgcattgagccattttgcttc |
31649026 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 18 - 77
Target Start/End: Original strand, 31648829 - 31648888
Alignment:
| Q |
18 |
ttaaccaatctaataacttctttatcaagttccttcttttccgtatttttatcttcaacc |
77 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31648829 |
ttaatcaatctaataacttctttatcaagttccttcttttccgtatttttatcttcaacc |
31648888 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University