View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16533_low_144 (Length: 215)
Name: NF16533_low_144
Description: NF16533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16533_low_144 |
 |  |
|
| [»] scaffold0365 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0365 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: scaffold0365
Description:
Target: scaffold0365; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 20 - 197
Target Start/End: Original strand, 2135 - 2312
Alignment:
| Q |
20 |
ctaatcacaatcctccgttcggttggtgcatccgaatgttggcacaaacatggaactttccttgaacaccttattgatattttccgcattctccatcttt |
119 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2135 |
ctaatcacaatcctccgttctgttggtgcatctgaatgttggcacaaacatggaactttccttgaacaccttattgatattttccgcattctccatcttt |
2234 |
T |
 |
| Q |
120 |
ggaaatctccatactccgtgtctctttgtggcctattccactcagcatactccaattcctatgttaatcttgctatct |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2235 |
ggaaatctccatactccgtgtctctttgtggcctattccactcagcatactccaattcctatgttaatcttgctatct |
2312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University