View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16533_low_152 (Length: 207)
Name: NF16533_low_152
Description: NF16533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16533_low_152 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 1 - 189
Target Start/End: Complemental strand, 8438445 - 8438257
Alignment:
| Q |
1 |
gacgtgttgttatcacaaaagcaacaggcacagcagcttcagatgctaagaagaaaaaagatgcaagagttcaaagagttcacagcatagaagagttcga |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
8438445 |
gacgtgttgttatcaccaaagcaacaggcacagcagcttcagatgctaagaagaaaaaagatgcaagagttcaaagagttcatagcatagaagagttcga |
8438346 |
T |
|
| Q |
101 |
cgaagcacttgaatcagcaaaagacaaactcgttgttgttgagtacgctacaagcgacgactcagaaagcatagagatataccctttct |
189 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8438345 |
cgaagcacttgaatcagcaaaagataaactcgttgttgttgagtacgctacaagcgacgactcagaaagcatagagatataccctttct |
8438257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University