View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16533_low_48 (Length: 421)
Name: NF16533_low_48
Description: NF16533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16533_low_48 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 104; Significance: 1e-51; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 104; E-Value: 1e-51
Query Start/End: Original strand, 11 - 162
Target Start/End: Original strand, 12830788 - 12830939
Alignment:
| Q |
11 |
tgagatgaatgaggggcaagactttgaccattgttggctaatgcatcaaccacgttaaaagtagaaagnnnnnnnnctatgaacataacctaaatttaga |
110 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||||||||||||| |||| || ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
12830788 |
tgagaagaatgaggggcaagactttgaccattcttggctaatgcatcagccacatttaaagtagaaagaaaataaactatgaacataacctaaatttaga |
12830887 |
T |
|
| Q |
111 |
gacacgcacatcttaactaactatatagaatctcattgaataaattacggtg |
162 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
12830888 |
gacacgcacatcttaactaactatatagaatcttattgaataaattacggtg |
12830939 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 314 - 405
Target Start/End: Original strand, 12831091 - 12831182
Alignment:
| Q |
314 |
gtttcatataccttctcctgggcctttgcttctgccctagccttacgcatggcattcatgtcttgaagcttatctttaacagcctgcatttt |
405 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12831091 |
gtttcatataccttctcctgggcctttgcttctgccctagccttacgcatggcattcatgtcttgaagcttatctttaacagcctgcatttt |
12831182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University