View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16533_low_53 (Length: 398)
Name: NF16533_low_53
Description: NF16533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16533_low_53 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 16 - 393
Target Start/End: Original strand, 44343423 - 44343800
Alignment:
| Q |
16 |
aaaactcaacatccctgcttcagatatcaaatttgataatgtattattatta---cctgataatctttccggttcagggaaatgatagtagactgggcaa |
112 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||| |||||||| |
|
|
| T |
44343423 |
aaaactcaacatccctgcttcaaatatcaaatttgataatgtattattattattacctgataatctttccggttcaaggaaatgatagtaggctgggcaa |
44343522 |
T |
 |
| Q |
113 |
gagcatacaagaatcatttattggtctcnnnnnnnnnnnnnnnngaaattaaaggaccgttggtgtctgtctttattattttattagtttgggttccatg |
212 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||| |||| |
|
|
| T |
44343523 |
gagcatacaagaatcattcattggtctctttattttctttttt-gaaattaaaggaccgttggtgtctgtctttattattt-attagtttgggttgcatg |
44343620 |
T |
 |
| Q |
213 |
catggttatactttcaaacatgttcctaatcctcgatcttaggcctactctgattcttgtag---attggggacagacatccgaatatatattaggaatc |
309 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44343621 |
catggttatactttcaaacatgttcctaatcctc----ttaggcctactcggattcttgtagtagattggggacagacatccgaatatatattaggaatc |
44343716 |
T |
 |
| Q |
310 |
tgcctgctgtcggtgtataagttggtctcatcaacgatctaactatccttaacactccctctctcacactatcttcatctctgt |
393 |
Q |
| |
|
||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
44343717 |
tgcgtgctgtctgtgtataagttggtctcatcaacgatctaactatccttaacactccctctctcacactatcttcatcactgt |
44343800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University