View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16533_low_62 (Length: 371)
Name: NF16533_low_62
Description: NF16533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16533_low_62 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 1 - 353
Target Start/End: Original strand, 33571609 - 33571961
Alignment:
| Q |
1 |
atttcttctcctcctcccactcatcgacctaacaacaccaaca------tccccacaatctctttccggcgcaactctccggcaaggcttcccattccca |
94 |
Q |
| |
|
|||||| |||||||||||||||| ||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||| || |
|
|
| T |
33571609 |
atttctcctcctcctcccactcaccgacctaacaacaccaacaccaacatccccacaatcactttccggcgcaactctccggcaaggcttcc------ca |
33571702 |
T |
 |
| Q |
95 |
tcaccagaaaacatcacaatctgtttcctaccaaccccacatttctcaccacttttcgttaaagccgagctagccttcacagccaacgccgccatttcca |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
33571703 |
tcaccagaaaacatcacaatctgtttcctaccaaccccacatttctcaccacttttcgttagagccgagctagccttcacggccaacgccgccatttcca |
33571802 |
T |
 |
| Q |
195 |
ccaccggtaacggcttcttcaaccgtgtcaacggcaaagcaaaataaagctgaccaagtctcaaaacctcatcttcatgcatggctaaaacaacatcatc |
294 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33571803 |
ccaccggcaacggcttcttcaaccgtgtcaacggcaaagcaaaataaagctgaccaagtctcaaaacctcatcttcatgcatggctaaaacaacatcatc |
33571902 |
T |
 |
| Q |
295 |
gaatcccatctcatcagaatcacatatgaaacaatcagggtataattgtaatacatacc |
353 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33571903 |
gaatcccatctcatcagaatcacatatgaaacaatcagggtataattgtaatacatacc |
33571961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University