View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16533_low_69 (Length: 348)
Name: NF16533_low_69
Description: NF16533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16533_low_69 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 50; Significance: 1e-19; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 283 - 340
Target Start/End: Original strand, 33203363 - 33203420
Alignment:
| Q |
283 |
gactatttagataagctccatcacctcattctttgttgaaaccttcatccttcatctc |
340 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
33203363 |
gactatttagataagcttcatcacctcattctttgttgaaaccttcatcattcatctc |
33203420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 283 - 340
Target Start/End: Original strand, 33203430 - 33203487
Alignment:
| Q |
283 |
gactatttagataagctccatcacctcattctttgttgaaaccttcatccttcatctc |
340 |
Q |
| |
|
||||| |||||||||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
33203430 |
gactacttagataagctccatcacctcattctctgttgaaaccttcatccttcgtctc |
33203487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University