View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16533_low_71 (Length: 342)
Name: NF16533_low_71
Description: NF16533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16533_low_71 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 294; Significance: 1e-165; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 1 - 294
Target Start/End: Original strand, 45335907 - 45336200
Alignment:
| Q |
1 |
atttcattttaaagggagtatattctatttctaattctgtttgtaatcaaacttttttgttttaactcctggtctattatttcacacaaaaagaaagaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45335907 |
atttcattttaaagggagtatattctatttctaattctgtttgtaatcaaacttttttgttttaactcctggtctattatttcacacaaaaagaaagaaa |
45336006 |
T |
|
| Q |
101 |
ggtggtctaggctataattcacaaagtcgtcaagggtatttccattttaataaagccctgacctttgctttatatctataaaactatttgctaaaaccct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45336007 |
ggtggtctaggctataattcacaaagtcgtcaagggtatttccattttaataaagccctgacctttgctttatatctataaaactatttgctaaaaccct |
45336106 |
T |
|
| Q |
201 |
aaaatagagcagctggcgatatgccttgttcgttgtacctgaaacttaggtgttggagtctcaactcaattttccggaaaacgcaggtgtagtc |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45336107 |
aaaatagagcagctggcgatatgccttgttcgttgtacctgaaacttaggtgttggagtctcaactcaattttccggaaaacgcaggtgtagtc |
45336200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 291 - 324
Target Start/End: Original strand, 45338928 - 45338961
Alignment:
| Q |
291 |
agtcagctaccagaaacagcgagaagtctactct |
324 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
45338928 |
agtcggctaccagaaacagcgagaagtctactct |
45338961 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University