View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16533_low_77 (Length: 319)
Name: NF16533_low_77
Description: NF16533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16533_low_77 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 1 - 285
Target Start/End: Original strand, 4458214 - 4458498
Alignment:
| Q |
1 |
gagtcaatggtacatactccgattcttcaattatagtgttcgacaaatatttccacttcattaagattgtcccttgctactttaatcatatccataacat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4458214 |
gagtcaatggtacatactccgattcttcaattatagtgttcgacaaatatttccacttcattaagattgtcccttgctactttaatcatatccataacat |
4458313 |
T |
 |
| Q |
101 |
gattatcaaattgtcttacgacattcacaaatattcagatccaatttcatacctttatacaacttcaagtaagaaatcataacaatattgtggtaaccca |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4458314 |
gattatcaaattgtcttacgacatttacaaatattcagattcaatttcatacctttatacaacttcaagtaagaaatcataacaatattgtggtaacccc |
4458413 |
T |
 |
| Q |
201 |
taaaatgtttcaccatactttcaatgtcaaatagattgatcaaatttggctctatcttgtcccaaacatcagtttcatcaccaac |
285 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
4458414 |
tacaatgtttcaccatactttcaatgtcaaatagattgatcaaatttggctctatcttgccccaaacatcagtttcatcaccaac |
4458498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 36 - 108
Target Start/End: Original strand, 17541805 - 17541877
Alignment:
| Q |
36 |
gtgttcgacaaatatttccacttcattaagattgtcccttgctactttaatcatatccataacatgattatca |
108 |
Q |
| |
|
|||||| ||||| ||||| |||||||| ||| ||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
17541805 |
gtgttcaacaaaaatttctacttcattcccattagcccttgcaactttaaccatatccataacatgattatca |
17541877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 127 - 231
Target Start/End: Original strand, 17541895 - 17541999
Alignment:
| Q |
127 |
acaaatattcagatccaatttcatacctttatacaacttcaagtaagaaatcataacaatattgtggtaacccataaaatgtttcaccatactttcaatg |
226 |
Q |
| |
|
||||||||| ||||| || ||| |||||||||| ||||| |||||| | || |||| ||||||||||| || |||||||||||| ||||||||| |
|
|
| T |
17541895 |
acaaatattgagatcagatgtcacacctttatacggcttcatgtaagacaatttagcaattatgtggtaacccttacaatgtttcaccaaactttcaatc |
17541994 |
T |
 |
| Q |
227 |
tcaaa |
231 |
Q |
| |
|
||||| |
|
|
| T |
17541995 |
tcaaa |
17541999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University