View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16533_low_78 (Length: 318)
Name: NF16533_low_78
Description: NF16533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16533_low_78 |
 |  |
|
| [»] scaffold0168 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0168 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 19 - 297
Target Start/End: Original strand, 25235 - 25513
Alignment:
| Q |
19 |
aatgcaggtggtaaaaaactatatgtacctcgagtggaggataaaaatagtcacatgcgtatgcttaacatatcgcgtattgatgatcttgttgcaaact |
118 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25235 |
aatgcaggtgataaaaaactatatgtacctcgagtggaggataaaaatagtcacatgcgtatgcttaacatatcgcgtattgatgatcttgttgcaaact |
25334 |
T |
 |
| Q |
119 |
caatgaacatcttagaaccaactccagttgatgccgatggaaatgcacgtcaagatggtacttctctctcttttgttgttcgattttttcttgtcattta |
218 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| || |
|
|
| T |
25335 |
cgatgaacatcttagaaccaactccagttgatgccgatggaaatgcacgtcaagatggtacttctctctctttcattgttcgattttttcttttcatgta |
25434 |
T |
 |
| Q |
219 |
ctgtccaattctcttatcttacttttgctgtcaaagattttgccaactttcaaaatgccaccatggtcaactcatacta |
297 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
25435 |
ctgtccaattctcttatcttactttagctgtcaaagatgttgccaactttcaaaatgccaccattgtcaactcatacta |
25513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University