View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16533_low_84 (Length: 306)
Name: NF16533_low_84
Description: NF16533
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16533_low_84 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 165; Significance: 3e-88; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 165; E-Value: 3e-88
Query Start/End: Original strand, 1 - 177
Target Start/End: Original strand, 4115494 - 4115670
Alignment:
| Q |
1 |
gtgatatattgtcatatcacaagaacatgatatattgttgcctgagttcaagtctacagtttctcacttctcagcacttagttataatgatatccacaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| || ||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4115494 |
gtgatatattgtcatatcacaagaacatgatatattgttgcccgaattcaaatctacagtttctcacttctcagcacttagttataatgatatccacaca |
4115593 |
T |
 |
| Q |
101 |
aagagacgacggcaccttgtcaattggtgtgttgggtttatctttattgtcaatgtgttagtattttcactttagtc |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4115594 |
aagagacgacggcaccttgtcaattggtgtgttgggtttatctttattgtcaatgtgttagtattttcactttagtc |
4115670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 206 - 269
Target Start/End: Original strand, 4115671 - 4115737
Alignment:
| Q |
206 |
attaagttaattatgagttagttaatcaatattcacatatcccataat---agagtatgcttatctg |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
4115671 |
attaagttaattatgagttagttaatcaatattcacatatcccataattagagagtatgcttatctg |
4115737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University