View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16534_high_2 (Length: 417)
Name: NF16534_high_2
Description: NF16534
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16534_high_2 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 8e-65; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 8e-65
Query Start/End: Original strand, 275 - 400
Target Start/End: Original strand, 4658935 - 4659060
Alignment:
| Q |
275 |
cttgtagtgtattgtggcagaggtgataggaaaactgccaagggcaaacggttcagccattcgtttggaaatgtaatgttcttttttcccaattccccca |
374 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4658935 |
cttgtagtgtattgtggcagaggtgataggaaaactgccaagggcaaacggttcagccattcgtttggaaatgtaatgttcttttttcccaattccccca |
4659034 |
T |
|
| Q |
375 |
cttatttcaattattgagtgtatgtt |
400 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
4659035 |
cttatttcaattattgagtgtatgtt |
4659060 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 109 - 212
Target Start/End: Original strand, 4658769 - 4658872
Alignment:
| Q |
109 |
ccactcatcacttcatcattccctaccctctcttcaaccttgtctctttcaccaaccccttctggtaacttttttctccnnnnnnnntggaaattttgtt |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
4658769 |
ccactcatcacttcatcattccctaccctctcttcaaccttgtctctttcaccaaccccttctggtaacttttttctccaaaaaaaatggaaattttgtt |
4658868 |
T |
|
| Q |
209 |
gtga |
212 |
Q |
| |
|
|||| |
|
|
| T |
4658869 |
gtga |
4658872 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University