View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16534_low_3 (Length: 345)
Name: NF16534_low_3
Description: NF16534
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16534_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 308; Significance: 1e-173; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 308; E-Value: 1e-173
Query Start/End: Original strand, 21 - 336
Target Start/End: Complemental strand, 44546921 - 44546606
Alignment:
| Q |
21 |
ttgaatctcctttttcacactttcatcaacaaatgtagctttcacagctgaaacaccttcttcctcattcacatcgttcttttctggaatctttatcgga |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44546921 |
ttgaatctcctttttcacactttcatcaacaaatgtagctttcacagctgaaacaccttcttcctcattcacatcgttcttttctggaatctttatcgga |
44546822 |
T |
 |
| Q |
121 |
cgtcctcttttccttttaccagcatttttatttccttttgaagccacatcacttttcttattgttaatcccacgtttcctagcagcagagccagagagtt |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44546821 |
cgtcctcttttccttttaccagcatttttatttccttttgaagccacatcacttttcttattgttaatcccacgtttcctagcagcagagccagagagtt |
44546722 |
T |
 |
| Q |
221 |
ttgttgcacctttcaatttcctacccctaccgcccttctttgaaaccacacgatttgtttgaacattacgtctctttccaccaagtttaccctttttctt |
320 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
44546721 |
ttgttgcacctttcaatttcctacccctaccacccttctttgaaaccacacgatttgtttgaacattacgtctctttccaccaagtttatcctttttctt |
44546622 |
T |
 |
| Q |
321 |
tgttgcacatgatgat |
336 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
44546621 |
tgttgcacatgatgat |
44546606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University