View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16535_high_16 (Length: 373)
Name: NF16535_high_16
Description: NF16535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16535_high_16 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 67 - 355
Target Start/End: Original strand, 38824882 - 38825165
Alignment:
| Q |
67 |
ttccttgcgagtttaacgactaatcgcaagtcgagcagaataaactcaatttcatttcatagtttgctaaaaattgagtttataggccgagtcaacttga |
166 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38824882 |
ttccttgtgagtttaacgactaatcgcaagtcgagcagaataaactgaatttcatttcatagtttgctaaaaattgagtttataggccgagtcaacttga |
38824981 |
T |
 |
| Q |
167 |
aattgatacctaaacttgtggaatcaagttgaattaactcgcgattttaacgaagttgctcacaattttgtttaaccataatttgtctgcgatggaacaa |
266 |
Q |
| |
|
||||||||||||||||||||||||| || |||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38824982 |
aattgatacctaaacttgtggaatc-----gagttaactcgcgattttaaccaagttgctcacaattttctttaaccataatttgtctgcgatggaacaa |
38825076 |
T |
 |
| Q |
267 |
gtctcccttgtttgagtgtatagtagtatgttacaacattacccttttagacagtatagttatttgattggaaactgagtaggtggttt |
355 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
38825077 |
gtctcccttgtttgagtgtatagtagtatgttacaacattacccttttagacagtatagttatttgattggaaattgaataggtggttt |
38825165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University