View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16535_high_24 (Length: 338)
Name: NF16535_high_24
Description: NF16535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16535_high_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 299; Significance: 1e-168; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 299; E-Value: 1e-168
Query Start/End: Original strand, 9 - 323
Target Start/End: Complemental strand, 12642846 - 12642532
Alignment:
| Q |
9 |
gacatcatcacccccggcgtcgatccaaacggtcaaccaatcgatccgcgtcagatccaacaacactttgaagatttctacgaagatatcttcaccgagc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12642846 |
gacatcatcacccccggcgtcgatccaaacggtcaaccaatcgatccgcgtcagatccaacaacacttcgaagatttctacgaagatatcttcaccgagc |
12642747 |
T |
 |
| Q |
109 |
tttcgaaattcggttacgttgaaacgttgaatgtttgtgataatttggctgatcatatgattggtaatgtttatgtgctttttaaagaggaagatcatgc |
208 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12642746 |
tttcgaaattcggttacgttgaaacgttgaatgtttgtgataatttggctgatcatatgattggtaatgtttatgtgctttttaaagaggaagatcatgc |
12642647 |
T |
 |
| Q |
209 |
tgcggcggcgttagccagtttgagagggaggttttatgaagggaggccgattttagcggatttttctccggttacggattttcgtgaggcgacttgtcgg |
308 |
Q |
| |
|
||| || |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12642646 |
tgctgctgcgttagcgagtttgagagggaggttttatgaagggaggccgattttagcggatttttctccggttacggattttcgtgaggcgacttgtcgg |
12642547 |
T |
 |
| Q |
309 |
cagtatgaggagaat |
323 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
12642546 |
cagtatgaggagaat |
12642532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University