View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16535_high_36 (Length: 249)
Name: NF16535_high_36
Description: NF16535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16535_high_36 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 17724537 - 17724306
Alignment:
| Q |
1 |
ttcacgaaatgctcttccaacgaatcaatcttaatatcattcccacaaacactgctcgatctctgcgactgcaacaaaaccacgtcgttattaacgttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17724537 |
ttcacgaaatgctcttccaacgaatcaatcttcatatcattcccacaaaaactgcttgatctctgcgactgcaacaaaaccacgtcgttattaacgttgt |
17724438 |
T |
|
| Q |
101 |
ttttcttcacgttaacgctgttgtttttcattaacctacgtcgtcttcgatgtacggcttttctgaaaagcgcgatcgggacggagtagactgcgagtac |
200 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17724437 |
ttttcttcacgttaacgttgttgtttttcattaacctacgtcgtcttcgatgtacggcttttctgaaaagcgcgatcgggacggagtagactgcgagtac |
17724338 |
T |
|
| Q |
201 |
gacgacgtggacaaccgtgcatggacagcaac |
232 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
17724337 |
gacgacgtggacaaccgtgcatggacagcaac |
17724306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University