View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16535_high_38 (Length: 239)
Name: NF16535_high_38
Description: NF16535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16535_high_38 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 20 - 222
Target Start/End: Original strand, 30021948 - 30022150
Alignment:
| Q |
20 |
ttctactttacttgttgttgacttcctctctttggtgtattgggatcactaaatgatttgttttcttgattcataaatttgcattggtaaattataaaga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30021948 |
ttctactttacttgttgttgacttcctctctttggtgtattgggatcactaaatgatttgttttcttgattcataaatttgcattggtaaattataaaga |
30022047 |
T |
|
| Q |
120 |
agctactatcgatgcacacatcacacatgcaacgtgaagaaacaagtgcaaaggctatcaaaagatactagcattgtggtgactacttatgagggaattc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30022048 |
agctactatcgatgcacacatcacacatgcaacgtgaagaaacaagtgcaaaggctatcaaaagatactagcattgtggtgactacttatgagggaattc |
30022147 |
T |
|
| Q |
220 |
aca |
222 |
Q |
| |
|
||| |
|
|
| T |
30022148 |
aca |
30022150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University