View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16535_low_23 (Length: 342)
Name: NF16535_low_23
Description: NF16535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16535_low_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 305; Significance: 1e-172; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 305; E-Value: 1e-172
Query Start/End: Original strand, 16 - 324
Target Start/End: Original strand, 12532924 - 12533232
Alignment:
| Q |
16 |
actaggaatttactaaatgacctcattttcttctgaatttttgttcttattttgatactttatctatcttacgggtaatccgtgtcacttttaaaggaga |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12532924 |
actaggaatttactaaatgacctcattttcttctgaatttgtgttcttattttgatactttatctatcttacgggtaatccgtgtcacttttaaaggaga |
12533023 |
T |
 |
| Q |
116 |
ttagtaggataatgtcttaattaagatgaggtcagttttacaaagaagataagatccataatagtaccaaatttctatgattatgtatgttagctttgca |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12533024 |
ttagtaggataatgtcttaattaagatgaggtcagttttacaaagaagataagatccataatagtaccaaatttctatgattatgtatgttagctttgca |
12533123 |
T |
 |
| Q |
216 |
ctaattacacttgtgaatttttatctttgaactataaaacttgattgaaccgaaggatgttttctataaactaatagatctccaaaacatccttgctgga |
315 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12533124 |
ctaattacacttgtgaatttttatctttgaactataaaacttgattgaaccgaaggatgttttctataaactaatagatctccaaaacatccttgctgga |
12533223 |
T |
 |
| Q |
316 |
ttgaactat |
324 |
Q |
| |
|
||||||||| |
|
|
| T |
12533224 |
ttgaactat |
12533232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University