View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16535_low_28 (Length: 327)
Name: NF16535_low_28
Description: NF16535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16535_low_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 294; Significance: 1e-165; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 294; E-Value: 1e-165
Query Start/End: Original strand, 16 - 317
Target Start/End: Original strand, 39339600 - 39339901
Alignment:
| Q |
16 |
ttgacaagtatttaaaatttatgttttatattcacagcttcagacttgaagtaaacatgtttcattgtactactatcatttttcccgaaacacaatgtac |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39339600 |
ttgacaagtatttaaaatttatgttttatattcacagcttgagacttgaagtaaacatgtttcattgtactactatcatttttcccgaaacacaatgtac |
39339699 |
T |
|
| Q |
116 |
cactatctttttcactaatattgttgtctttatgctttatctaaagttgttttctttaactggttgcttgattgttatatagacatccatcctcaataaa |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39339700 |
cactatctttttcactaatattgttgtctttatgctttatctaaagttgttttctttaactggttgcttgattgttatatagacatccatcctcaataaa |
39339799 |
T |
|
| Q |
216 |
tgttttcttcttgtggttacacatgtatcagcaaaggcagtatatgcagctaatgtgtaggtacaaaatgacttattttgtgcacccattgacgtgtttc |
315 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39339800 |
tgttttcttcttgtggttacacatgtatcagcaaaggcagtatatgcagctaatgtgtaagtacaaaatgacttattttgtgcacccattgacgtgtttc |
39339899 |
T |
|
| Q |
316 |
at |
317 |
Q |
| |
|
|| |
|
|
| T |
39339900 |
at |
39339901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University