View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16535_low_46 (Length: 235)
Name: NF16535_low_46
Description: NF16535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16535_low_46 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 8 - 216
Target Start/End: Complemental strand, 38081971 - 38081767
Alignment:
| Q |
8 |
gactgatatgaactatttctattatgttatgatatcatgttaaactattgaaatggacccccctaacgtaaaatgtatggactaactggtcttgagagta |
107 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
38081971 |
gactgaaatgcactatttctattatgttatgatatcatgttaaactattgaaatggacccccccaacgtaaaatgtatggactaaccggtcttgagagta |
38081872 |
T |
 |
| Q |
108 |
ataattatgttatccaaaagatgtctagactttaaatcttctaatgaacataagcactcccaacttacatacatttttgtttctctttcatattactctt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
38081871 |
ataattatgttatccaaaagatgtctagactttaaatcttctaatgaacataagcactccca----acatacatttttgtttctctttcatattactctt |
38081776 |
T |
 |
| Q |
208 |
gttgtacaa |
216 |
Q |
| |
|
||||||||| |
|
|
| T |
38081775 |
gttgtacaa |
38081767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University