View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16535_low_47 (Length: 230)
Name: NF16535_low_47
Description: NF16535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16535_low_47 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 10 - 213
Target Start/End: Original strand, 9247424 - 9247627
Alignment:
| Q |
10 |
tgaaatgaatgaaagtttacttattttcttagccactactaaaataattttattttatatttgagtacggacggaatactcatgtactactacaaataaa |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9247424 |
tgaaatgaatgaaagtttacttattttcttagccactactaaaataattttattttatatctgagtacggacggaatactcatgtactactacaaataaa |
9247523 |
T |
|
| Q |
110 |
ctaatatgtatccatgattttattattaaaaataatttaattgataatgaaatgatggagaaaaatcgttttcaaaagatatacggtagatccaataagc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9247524 |
ctaatatgtatccatgattttattattaaaaataatttaattgataatgaaatgatggagaaaaatcgttttcaaaagatatacggtagatccaataagc |
9247623 |
T |
|
| Q |
210 |
atgc |
213 |
Q |
| |
|
|||| |
|
|
| T |
9247624 |
atgc |
9247627 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University