View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16535_low_8 (Length: 504)
Name: NF16535_low_8
Description: NF16535
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16535_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 11 - 242
Target Start/End: Original strand, 15630928 - 15631160
Alignment:
| Q |
11 |
cacagatactctactctatttcatcaattgcatgcggtactgaactcaataaggaacgcttgaccaataatacatgctttgcatctcgcaaagtaaagta |
110 |
Q |
| |
|
|||| ||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
15630928 |
cacacatactctactctactttatcaattgcatgcggtactgaactcaataaggaacgcttgaccaataatacatgctttgcatctcgcagagtaaagta |
15631027 |
T |
 |
| Q |
111 |
tcgctcattttggtgaatgccatagattgcacacgtaactagtttgataatatcaagtgctcgttagggtattcatctccaagccaccaaggacttttcc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
15631028 |
tcgctcattttggtgaatgccatagattgcacacgtaactaatttgataatatcaagtgctcgttagggtattcatctccaagccaccaaggacttttcc |
15631127 |
T |
 |
| Q |
211 |
cacccttgatcacgac-ttcgcatctccctcat |
242 |
Q |
| |
|
|||||||||||||||| || ||||||||||||| |
|
|
| T |
15631128 |
cacccttgatcacgactttggcatctccctcat |
15631160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University