View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16536_high_12 (Length: 204)
Name: NF16536_high_12
Description: NF16536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16536_high_12 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 17 - 186
Target Start/End: Original strand, 38811808 - 38811985
Alignment:
| Q |
17 |
taatactagtaaggaagctgcaaagcaagggcttatgatcatg--------gaaatgagaggttctttggccattctcaactttccacatgaacattttc |
108 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38811808 |
taatactagtaaggaagctgcaaaacaagggcttatgatcatgctgcttttgaaatgagaggttctttggccattctcaactttccacatgaacattttc |
38811907 |
T |
 |
| Q |
109 |
cttgcaatgtggtttataattcttctaagtcatcttcttcatccaattcaacgccatcattatcatcggcatcaccac |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38811908 |
cttgcaatgtggtttataattcttctaagtcatcttcttcatccaattcaacgccatcattatcatcggcatcaccac |
38811985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 60 - 175
Target Start/End: Original strand, 38809786 - 38809904
Alignment:
| Q |
60 |
gaaatgagaggttctttggccattctcaactttccacatgaacatt---ttccttgcaatgtggtttataattcttctaagtcatcttcttcatccaatt |
156 |
Q |
| |
|
|||||||||||||||| || ||||| |||||||| |||||||||| ||||||||| |||||| ||||| |||||||| | |||||||| ||||||| |
|
|
| T |
38809786 |
gaaatgagaggttcttcagctattcttaactttcctcatgaacattattttccttgcagtgtggtatataacccttctaagccgtcttcttcctccaatt |
38809885 |
T |
 |
| Q |
157 |
caacgccatcattatcatc |
175 |
Q |
| |
|
|||| |||||| |||||| |
|
|
| T |
38809886 |
caacctcatcatcatcatc |
38809904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University