View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16536_high_9 (Length: 258)
Name: NF16536_high_9
Description: NF16536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16536_high_9 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 118; Significance: 3e-60; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 11 - 168
Target Start/End: Original strand, 51094632 - 51094786
Alignment:
| Q |
11 |
tataggttgtattggatggatccaaaacaatcgatcatccattaagaattcactaaaattgttcaaaaggaatcaattcaattcacctatcagcgattaa |
110 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | |
|
|
| T |
51094632 |
tataggttgtattggatggatcaaaaacaatcgattatccattaagaattcactaaaattgttcaaaaggaatcaattcaattcacctatcag----tga |
51094727 |
T |
 |
| Q |
111 |
tatcctttcaatctatctatcagtgatttttgaatggatg-aataccctatcccttcaa |
168 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
51094728 |
tatcctttcaatctatctattagtgatttttgaatggatgaaataccctatcccttcaa |
51094786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University