View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16536_low_16 (Length: 249)
Name: NF16536_low_16
Description: NF16536
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16536_low_16 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 1091943 - 1092188
Alignment:
| Q |
1 |
tcatgttatcacatccctcaccaccagctgttggtcccaagcacctatcgaatactttctcacaaaccacagaaagtttattctcctgcataatcatgat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1091943 |
tcatgttatcacatccctcaccaccagctgttggtgccaagcacctatcgaatactttctcacaaaccacagaaagtttattctcctgcataatcatgat |
1092042 |
T |
|
| Q |
101 |
ttgatgtaaatgtaacaaccagattctataattgacgccatgtgaatgctccattcaagatatgtctatctgtacagtaaacaaggtgataatcgaaatc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
1092043 |
ttgatgtaaatgtaacaaccagattctataattggagccatgtgaatgctacattcaagatatgtctatctgtacagtaaacaaggtgataatcgaaaac |
1092142 |
T |
|
| Q |
201 |
tttccgtctttagctgtccatgtatgaagtccacaagctgctggct |
246 |
Q |
| |
|
|| ||||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
1092143 |
ttaccgtctttaactggccatgtatgaagtccacaagctgctggct |
1092188 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University