View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16537_high_1 (Length: 511)
Name: NF16537_high_1
Description: NF16537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16537_high_1 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 401; Significance: 0; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 401; E-Value: 0
Query Start/End: Original strand, 25 - 494
Target Start/End: Original strand, 38331781 - 38332263
Alignment:
| Q |
25 |
atatccttatcaacacaccggtagcaatttactag-aagcaggagta------tattggattccagcagatgaaaggggaaaagaaatcgttggtggaag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38331781 |
atatccttatcaacacaccggtagcaatttactagtaagcaggagtaggagtatattggattccagcagatgaaaggggaaaagaaatcggtggtggaag |
38331880 |
T |
 |
| Q |
118 |
aaatgacacgtgtaatataaattcctctattctatctatcgcttcaa------aataatatccaaaatccaatccaaacctattcctcttcttcaccacc |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38331881 |
aaatgacacgtgtaatataaattcctctattctatctatcgcttcaaaatcaaaataatatccaaaatccaatccaaacctattcctcttcttcaccacc |
38331980 |
T |
 |
| Q |
212 |
atcaacaacgcgatttagttccgttgttgaactcgaaatggctattttctctgcaaccctaggttccttcggtgccatctccttcctctcatcttcacaa |
311 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
38331981 |
atcaacaacgcgatttggttccgttgttgaactcgaaatggctattttctctgcaaccctaggttcctttggtgccatttccttcctctcatcttcacaa |
38332080 |
T |
 |
| Q |
312 |
tcacaacaacacgatccttcttcttcttccatcgtcaatcctttcaatttccctaaatgccctcacaagttaccaccaccttgccaatggcatcctcact |
411 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38332081 |
tcacaacaacacgatccttcttcttcttccatcgtcaatcctttcaatttccctaaatgccctcacaagttaccaccaccttgccaatggcatcctcact |
38332180 |
T |
 |
| Q |
412 |
atcgtcatcacaatcctaaaatcatggtatctagtactagtagtagtaacaatactcatattgatgaattcgaccgcggtctt |
494 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
38332181 |
atcgtcatcacaatcctaaaatcatggtatctagtagtagtagcagtaacaatactcatattgatgaattcgacagcggtctt |
38332263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University