View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16537_low_12 (Length: 269)
Name: NF16537_low_12
Description: NF16537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16537_low_12 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 233; Significance: 1e-129; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 17 - 260
Target Start/End: Complemental strand, 11072848 - 11072604
Alignment:
| Q |
17 |
caaagggacaaagaaagtgtgaaacttatgtgaaaagtatggttgtgtgtgcaggtagtggg-agatgaatcatggagtcctccggtgagcatgaaaggt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11072848 |
caaagggacaaagaaagtgtgaaacttatgtgaaaagtatggttgtgtgtgcaggtagtggggagatgaatcatggagtcctccggtgagcatgaaaggt |
11072749 |
T |
 |
| Q |
116 |
tttcagttagagaggttcatgccaatggaagtcgcatggccgcatcagaagttgaggctaagcttgatgaaggaaatattcaagaagcggaatctgcgtt |
215 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11072748 |
tttcggttagagaggttcatgccaatggaagtcgcatggccgcatcagaagttgaggctaagcttgatgaaggaaatattcaagaagcggaatctgcgtt |
11072649 |
T |
 |
| Q |
216 |
gcgagaagggttgtcactcaattttgaggttagtttgttgatgat |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11072648 |
gcgagaagggttgtcactcaattttgaggttagtttgttgatgat |
11072604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University