View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16537_low_15 (Length: 238)
Name: NF16537_low_15
Description: NF16537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16537_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 219
Target Start/End: Complemental strand, 44322571 - 44322343
Alignment:
| Q |
1 |
ttcttcttttgacttgagtgtaattctgtgcgtagacaaacaaatggtgtaactcgttccacttgtaatgaaaatctaattgtttgt----------atc |
90 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
44322571 |
ttcttcttttgacttgagtgtaattctgtgcgtagacaaacaaatggtgtaactcgttccacttgtaatgaaaatctaattgtttgtcaaatcatttatc |
44322472 |
T |
 |
| Q |
91 |
tattataactagaaaaagtggaaagctcgcattgaatcaggggcaaagattttaagtggcgggggtagaccatgactatgacccctacaagttatacttt |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44322471 |
tattataactagaaaaagtggaaagctcgcattgaatcaggggcaaagattttaagtggcgggggtagaccatgactatgacccctacaagttatacttt |
44322372 |
T |
 |
| Q |
191 |
tacagatgtatgtgtttattcgacgcaac |
219 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
44322371 |
tacagatgtatgtgtttattcgacgcaac |
44322343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University