View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16537_low_17 (Length: 230)
Name: NF16537_low_17
Description: NF16537
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16537_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 18 - 165
Target Start/End: Complemental strand, 573392 - 573244
Alignment:
| Q |
18 |
atgtttttggttcattgcttggaaagtagaattttgcttcggtgttgctttatgaaaatttacaaccatggggttgcttctctc-tttatgttccaagtc |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| || ||||||||||||||| |
|
|
| T |
573392 |
atgtttttggttcattgcttggaaagtagaattttgcttcggtgttgttttatgaaaatttacaaccatggggttgcttctttcttttatgttccaagtc |
573293 |
T |
 |
| Q |
117 |
tttagtttttgtatgtttaaatatgaaatttctttcatgggttgtctca |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
573292 |
tttagtttttgtatgtttaaatatgaaatttctttcatgggttgtctca |
573244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University