View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16538_low_3 (Length: 238)
Name: NF16538_low_3
Description: NF16538
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16538_low_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 111; Significance: 4e-56; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 120 - 230
Target Start/End: Original strand, 11452286 - 11452396
Alignment:
| Q |
120 |
tactagttaccatcataatgagaaggaggaaaagcattgggaataagaaaaagctggtagaacatggcagcagagaagagaagaagaggaagtgcgtagg |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11452286 |
tactagttaccatcataatgagaaggaggaaaagcattgggaataagaaaaagctggtagaacatggcagcagagaagagaagaagaggaagtgcgtagg |
11452385 |
T |
 |
| Q |
220 |
ctttgatgatg |
230 |
Q |
| |
|
||||||||||| |
|
|
| T |
11452386 |
ctttgatgatg |
11452396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 1 - 57
Target Start/End: Original strand, 11452168 - 11452224
Alignment:
| Q |
1 |
ataagcctccttcacttcatcaatcgaactatacatcttaattctcagaactgcatt |
57 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11452168 |
ataagcttccttcacttcatcaatcgaactatacatcttaattctcagaactgcatt |
11452224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University