View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16539_high_3 (Length: 306)
Name: NF16539_high_3
Description: NF16539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16539_high_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 5 - 272
Target Start/End: Original strand, 25566115 - 25566382
Alignment:
| Q |
5 |
agagaaagtgaaaggacttacaaagtgggagcagaagaggggaagccatgctaggcatatccaaggatgtaatattgtgtcatgtggtgatgatgttatt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25566115 |
agagaaagtgaaaggacttacaaagtggaagcagaagaggggaagccatgctaggcatatccaaggatgtaatattgtgtcatgtggtgatgatgttatt |
25566214 |
T |
 |
| Q |
105 |
gtttgcaaatggaatggataaaccaaatctagtttgtctagtttgaacaataaacattggaacattggattgtggtctgtgttttttcagagccaaagac |
204 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
25566215 |
gtttgcaaatggaacggataaaccaaatctagtttgtctagtttgaacaataaacattggaacattggattgtggtgtgtgttttttcagagccaaagac |
25566314 |
T |
 |
| Q |
205 |
actcttccacgtggcagatggataaatcattcaaagagtcatagttagagcttggagagttgctatcc |
272 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
25566315 |
actcttccacgtggcagatagataaatcattcaaagagtcatggttagagcttggacagttgctatcc |
25566382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University