View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF16539_low_8 (Length: 254)
Name: NF16539_low_8
Description: NF16539
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF16539_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 191; Significance: 1e-104; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 19 - 221
Target Start/End: Complemental strand, 14250035 - 14249833
Alignment:
| Q |
19 |
gcatcaccagcagcaacaaggctctatgggtgaagcttccgcggcgaggttagggaattatcttcctggtcatctgaatttgttggcttcattgtctggt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14250035 |
gcatcaccagcagcaacaaggctctatgggtgaagcttccgcggcgaggttagggaattatcttcctggtcatctgaatttgttggcttcattgtctggt |
14249936 |
T |
|
| Q |
119 |
gggaatggaaattctggtcgtggagatgatgaagatcgttgaaccggggaattccgtgttttctactttattcatgtttttagtatatatagatatgaat |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14249935 |
gggaatggaaattctggtcgtggagatgatgaagatcgttgaaacggggaattcggtgttttgtactttattcatgtttttagtatatatagatatgaat |
14249836 |
T |
|
| Q |
219 |
tat |
221 |
Q |
| |
|
||| |
|
|
| T |
14249835 |
tat |
14249833 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 42 - 160
Target Start/End: Original strand, 51615349 - 51615467
Alignment:
| Q |
42 |
ctatgggtgaagcttccgcggcgaggttagggaattatcttcctggtcatctgaatttgttggcttcattgtctggtgggaatggaaattctggtcgtgg |
141 |
Q |
| |
|
|||||||||||||||| || || || | ||||||||||||||||||||||| |||||| | ||||| ||||||||||| |||||||||||||||| | |
|
|
| T |
51615349 |
ctatgggtgaagcttcagctgctagagttgggaattatcttcctggtcatctcaatttgcttgcttcgttgtctggtggacatggaaattctggtcggag |
51615448 |
T |
|
| Q |
142 |
agatgatgaagatcgttga |
160 |
Q |
| |
|
|||||||||| ||| |||| |
|
|
| T |
51615449 |
agatgatgaacatcattga |
51615467 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University